View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13777_high_28 (Length: 435)

Name: NF13777_high_28
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13777_high_28
NF13777_high_28
[»] chr2 (1 HSPs)
chr2 (326-379)||(20018353-20018406)


Alignment Details
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 326 - 379
Target Start/End: Complemental strand, 20018406 - 20018353
Alignment:
326 attcctgtgttagtttttcaacttgtaagaacataaattttcaacttgtctaaa 379  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20018406 attcctgtgttagtttttcaacttgtaagaacataaattttcaacttgtctaaa 20018353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University