View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_high_28 (Length: 435)
Name: NF13777_high_28
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_high_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 326 - 379
Target Start/End: Complemental strand, 20018406 - 20018353
Alignment:
| Q |
326 |
attcctgtgttagtttttcaacttgtaagaacataaattttcaacttgtctaaa |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20018406 |
attcctgtgttagtttttcaacttgtaagaacataaattttcaacttgtctaaa |
20018353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University