View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_high_48 (Length: 362)
Name: NF13777_high_48
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_high_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 176 - 279
Target Start/End: Complemental strand, 18037121 - 18037018
Alignment:
| Q |
176 |
ctttgttcattttcccatttgtaccgatgataataagaaaacacataaacaaatatgaaggatcacaattttaactgaaaagtgaattttacacattcaa |
275 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
18037121 |
ctttgttccttttcccatttgtatcgatgataataagaaaacacataaacaaatatgaaggatcactattttaactgaaaagtgaattttacacattcaa |
18037022 |
T |
|
| Q |
276 |
attt |
279 |
Q |
| |
|
|||| |
|
|
| T |
18037021 |
attt |
18037018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 307 - 345
Target Start/End: Complemental strand, 18036023 - 18035985
Alignment:
| Q |
307 |
tggaatgcacacatttctcaaaatataaaaccaactttc |
345 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18036023 |
tggaatgcacacatttctcaaaatataaaaccaactttc |
18035985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 29 - 144
Target Start/End: Original strand, 31958031 - 31958145
Alignment:
| Q |
29 |
aaatgtttgtgcatattatattgctaagtttggagatggcaatcacgacgcgttttggtctattgcgttgcctccgaatggaattctcctccaactgcta |
128 |
Q |
| |
|
|||| |||||||| |||||||||||||| |||||| ||||| ||| |||||||||||||| || ||| || || ||| |||||||||||| |||||| |
|
|
| T |
31958031 |
aaatatttgtgcagattatattgctaagcttggagctggcagtcaagacgcgttttggtc-atcgcggagcatcaagatgcaattctcctccacctgcta |
31958129 |
T |
|
| Q |
129 |
gctgatgctagtggga |
144 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
31958130 |
ggcgatgctagtggga |
31958145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University