View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_high_60 (Length: 327)
Name: NF13777_high_60
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_high_60 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 14 - 188
Target Start/End: Complemental strand, 36781719 - 36781545
Alignment:
| Q |
14 |
gatttgatgactttgcaatatattaggctacctgacattagatcaaagagcataattgtggagtcttaaagaatagaatggcaaattaggtcttgatcaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36781719 |
gatttgatgactttgcaatatattaggctacctgacatgagatcaaagagcataattgtggagtcttaaagaatagaatggcaaattaggttttgatcaa |
36781620 |
T |
 |
| Q |
114 |
gcatacaaagccaaaagaaaataagttgaaatcatacaaaacgtgaataatttatttaaattgtcacgtcatcaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36781619 |
gcatacaaagccaaaagaaaataagttgaaatgatacaaaacgtgaataatttatttaaattgtcacgtcatcaa |
36781545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University