View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_high_92 (Length: 239)
Name: NF13777_high_92
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_high_92 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 24 - 223
Target Start/End: Original strand, 35772401 - 35772601
Alignment:
| Q |
24 |
ggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35772401 |
ggtttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattg |
35772500 |
T |
 |
| Q |
124 |
atctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatcttttcatccatttactc-aaacccacatcctagattt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35772501 |
atctctacaaattcgacccatgggaactcccaagtatcaaactttttcacaccccatttcatcttttcatccatttactcaaaacccacatcctagattt |
35772600 |
T |
 |
| Q |
223 |
t |
223 |
Q |
| |
|
| |
|
|
| T |
35772601 |
t |
35772601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 27 - 148
Target Start/End: Original strand, 33761848 - 33761969
Alignment:
| Q |
27 |
ttccgattccaccctaccgatgaagaactcgttgttcactacctcaaaagaaaagctgcttctgcacctcttccagtagccatcatagcagagattgatc |
126 |
Q |
| |
|
|||||||| |||||||| |||||||| || |||||||| |||||||| | |||||| ||||| || ||| | ||||||||||||||||| || |||||| |
|
|
| T |
33761848 |
ttccgatttcaccctacagatgaagagcttgttgttcattacctcaagaaaaaagcagcttcagctcctttaccagtagccatcatagctgaagttgatc |
33761947 |
T |
 |
| Q |
127 |
tctacaaattcgacccatggga |
148 |
Q |
| |
|
|||||||||| || |||||||| |
|
|
| T |
33761948 |
tctacaaatttgatccatggga |
33761969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University