View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_101 (Length: 236)
Name: NF13777_low_101
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_101 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 41237782 - 41237561
Alignment:
| Q |
1 |
ataaaagattaactgtaaactataaataaatggaactaatattagtggtcgggcctagcaaaaggaactagttctcgacaatgtgacgaacctaagttcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41237782 |
ataaaagattaactgtaaactataaataaatggaactaatattagtggtcgggcctagcaaaaggaactagttctcgacaatgtgacgaacctaagttca |
41237683 |
T |
 |
| Q |
101 |
aattcttgctggaaaaggcagccacatttagtacgtgacgacccc-cgaccccttccaccctccatttgtgtaattatctgtcttttccgtatccaaact |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41237682 |
aattcttgctggaaaaggcagccacatttagtacgtgacgacccctcgaccccttccaccctccatttgtgtaattatctgtcttttccgtatccaaact |
41237583 |
T |
 |
| Q |
200 |
ttaagtgtataagggtgctttg |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
41237582 |
ttaagtgtataagggtgctttg |
41237561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University