View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_106 (Length: 229)
Name: NF13777_low_106
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_106 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 190
Target Start/End: Original strand, 40152189 - 40152378
Alignment:
| Q |
1 |
tcttttctttctttgtaagaaaaagaaaagaaaatattaaatgtcttgacatttttgggatgactcaactcatagtggaccgagtcaatgtcggtgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40152189 |
tcttttctttctttgtaagaaaaagaaaagaaaatattaaatgtcttgacatttttgggatgactcaactcatagtggaccgagtcaatgtcggtgtttc |
40152288 |
T |
|
| Q |
101 |
gcaaaagatttttacgtgtataccctcatatttaataagcatatcccttacatttcccatttcgccctaaataaattttgatttcatatt |
190 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40152289 |
gcaaaagatttttacgtgtatacccttatatttaataagcataccccttacatttcccatgtcgccctaaataaattttgatttcatatt |
40152378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University