View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_108 (Length: 227)
Name: NF13777_low_108
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_108 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 4951355 - 4951158
Alignment:
| Q |
7 |
gatccgtccctgcttgatcttattatagtatcaacaaatttttaagctaacgtccattgtacagaacaaataaatagttgcttgtgtcacaatagaaaac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4951355 |
gatccgtccctgcttgatcttattatagtatcaacaaatttttaagctaacgtccattgtacagaacaa----------------------atagaaaac |
4951278 |
T |
|
| Q |
107 |
ttttgtcttttgtgggcccaagggagataagaggaatgaggtgatgcacgtgcaatagtaaaacaatgtatcatatgttttgaaagaacatccaaaaggg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951277 |
ttttgtcttttgtgggcccaagggagataagaggaatgaggt-atgcacgtgcaatagtaaaacaatgtatcatatgttttgaaagaacatccaaaaggg |
4951179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 147 - 227
Target Start/End: Original strand, 10484665 - 10484746
Alignment:
| Q |
147 |
gtgatgcacgtgcaatagtaaaacaatgtatcatatgttttgaaagaacatc--caaaagggtgtccattgttgaacagagta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
10484665 |
gtgatgcacgtgcaatagtaaaacaatgtatcatat-ttttgaaagaacatcagaaaaagggtgtccattgttgaacatagta |
10484746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University