View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13777_low_112 (Length: 215)

Name: NF13777_low_112
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13777_low_112
NF13777_low_112
[»] chr2 (1 HSPs)
chr2 (27-148)||(30347877-30347998)


Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 27 - 148
Target Start/End: Original strand, 30347877 - 30347998
Alignment:
27 ctaatttgtgtctctaagttcttaattgatgtctcagtatttctttgagattcctcatgatttttcgagagagcatcaatgtgaccatgagtagtgttca 126  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30347877 ctaatttgtgtctctaagttcttaattgatgtttcagtatttctttgagattcctcatgatttttcgagagagcatcaatgtgaccatgagtagtgttca 30347976  T
127 tatgttgggttaggactccttc 148  Q
    ||||||||||||||||||||||    
30347977 tatgttgggttaggactccttc 30347998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University