View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_113 (Length: 209)
Name: NF13777_low_113
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_113 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 16 - 118
Target Start/End: Original strand, 16398943 - 16399049
Alignment:
| Q |
16 |
atgaatgaagaaatgaaagtt----agttagttagttagttaatgagcaaaatatagtatatgattaatttaccagtgaggattggatcggagttacatg |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16398943 |
atgaatgaagaaatgaaagttagttagttagttagttagttaatgagcaaaatatagtatatgattaatttaccagtgaggattggatcggagttacatg |
16399042 |
T |
 |
| Q |
112 |
tagcaat |
118 |
Q |
| |
|
||||||| |
|
|
| T |
16399043 |
tagcaat |
16399049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University