View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_116 (Length: 201)
Name: NF13777_low_116
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_116 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 19 - 178
Target Start/End: Complemental strand, 37919342 - 37919183
Alignment:
| Q |
19 |
agatttgatgatgaagcttctggatccaacgattaactcaactgatttctctgtttcattttgtcaaaaatcgcgatacagtgcagcttgaaatagtata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37919342 |
agatttgatgatgaagcttctggatccaacgattaactcaactgatttctctgtttcattttgtcaaaaatcgcgatacagtgcagcttgaaatagtata |
37919243 |
T |
 |
| Q |
119 |
atgcacgaaagtgaatcacacacgatcatagaaaattgtggagtgattttctcggggtat |
178 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37919242 |
atgtacgaaagtgaatcacacacgatcatagaaaattgtggagtgattttctcggggtat |
37919183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University