View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_24 (Length: 479)
Name: NF13777_low_24
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 11 - 407
Target Start/End: Complemental strand, 35826853 - 35826452
Alignment:
| Q |
11 |
cataggggtcaacaacatcagatcataacacacacatcattttctacagaccattgttgatgtgaaggattcacgcttgcatgttgaattgcatgccaca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35826853 |
cataggggtcaacaacatcagatcataacacacacatcattttctacagaccattgttgatgtgaaggattcacgcttgcatgttgaattgcatgccaca |
35826754 |
T |
|
| Q |
111 |
acctttgcacgtgcaaagttttttatttgagtgtggggtccactaaagccagagtggctcgtgtcaagttagtcaggtcacggtcaagccgtgtgggttg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35826753 |
acctttgcacgtgcaaagttttttatttgagtgtggggtccactaaagccagagtggctcgtgtcaagttagtcaggtcacggtcaagccgtgtgagttg |
35826654 |
T |
|
| Q |
211 |
ggtcttgatgttggctaggggactgagcccatgggtcacgtgaacgatcgacac-----nnnnnnnnnnngaagaacgatcgacacttttgtttaccaac |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
35826653 |
ggtcttgatgttggctaggggactgagcccatgggtcacgtgaacgatcgacacttttttttttttttttgaagaacgatcgacccttttgtttaccaac |
35826554 |
T |
|
| Q |
306 |
tttatcttctttttatggttacaaaagcttttcattgctctttgtctttgattatcaaccacttgaattaccggggaaagcaaagaatgatatttaatta |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35826553 |
tttatcttctttttatggttacaaaagcttttcattgctctttgtctttgattatcaaccacttgaattacgagggaaagcaaagaatgatatttaatta |
35826454 |
T |
|
| Q |
406 |
gc |
407 |
Q |
| |
|
|| |
|
|
| T |
35826453 |
gc |
35826452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University