View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_57 (Length: 349)
Name: NF13777_low_57
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 189 - 331
Target Start/End: Complemental strand, 32916332 - 32916190
Alignment:
| Q |
189 |
ttcctgagagatttgaccttaactaaagttcattaaccacttcaagccaagcacttgatttaataatgctttgttacaataagaaaaacaaataaattag |
288 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
32916332 |
ttcctgagagattcgaccttaactaaagttcattaaccacttcaagccatccacttgatttaataatgctttattacaataaaaaaaacaaataaattag |
32916233 |
T |
 |
| Q |
289 |
cattacccttcgaaaataatagcagtatcaaacacaccatggc |
331 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32916232 |
cattacccttcgaaaataatagcagtatcaaacacaccatggc |
32916190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 13 - 70
Target Start/End: Complemental strand, 32916410 - 32916352
Alignment:
| Q |
13 |
aatataaacatca-gatcaaagaaaaaatatgaacattcaaagtaaaaccaataatgta |
70 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32916410 |
aatataaacatcaagatcaaagaaaaaatatgaacattcaaagtaaaaccaataatgta |
32916352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University