View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_67 (Length: 308)
Name: NF13777_low_67
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 46 - 292
Target Start/End: Complemental strand, 34341083 - 34340837
Alignment:
| Q |
46 |
atggaagggagaaagagtgctcagtagtgtttgttgaattacggacatagaacctaaggaccaaattctcctccgggacttacccttttcaattgataac |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34341083 |
atggaagggagaaagagtgctcagtagtgtttgttgaattacggacatagaacctaaggaccaaattctcctccgggacttacccttttcaattgataac |
34340984 |
T |
 |
| Q |
146 |
aaggttcctctacctgtacctccccttatttaatgtaactaatcttgctgtcaaaactcaaaactacctatttttgtttgtaattggtgattctcaaaat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340983 |
aaggttcctctacctgtacctccccttatttaatgtaactaatcttgctgtcaaaactcaaaactacctatttttgtttgtaattggtgattctcaaaat |
34340884 |
T |
 |
| Q |
246 |
tgataagggtatgcttaacgatttcttttatttctttatgcagcttc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34340883 |
tgataagggtatgcttaacgatttcttttatttctttatgcagcttc |
34340837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University