View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_68 (Length: 306)
Name: NF13777_low_68
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_68 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 286
Target Start/End: Original strand, 49411314 - 49411594
Alignment:
| Q |
13 |
gtgagaagaatggctaggggtaagcatagaagtagtgcacataaaagagaaagtgggtttggtgatagcatcgttggagatgagagatgcttttagaagg |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411314 |
gtgaaaagaatggctaggggtaagcatagaagtagtgcacataaaagagaaagtgggtttggtgatagcatcgttggagatgagagatgcttttagaagg |
49411413 |
T |
 |
| Q |
113 |
aagctagggatgatgc-----------tataaattgacgttgaaggaagataaaatatcatattattagccaaagcactcataatcttaatcattttgtg |
201 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411414 |
aagctagggatgatgcaaagataatgctataaattgatgttgaaggaagataaaatatcatattattagccaaagcactcataatcttaatcattttgtg |
49411513 |
T |
 |
| Q |
202 |
atttctaactatttacattatgtggtttcgggtttgcatgcttgatttttgtttgtttcccttttctaaggttcagaggtactat |
286 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
49411514 |
atttctagctatttacattatgtggtttcgggtttgcatgcttgatt----tttgtttcccttttctaagattcagaggtactat |
49411594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University