View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_82 (Length: 269)
Name: NF13777_low_82
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_82 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 36 - 254
Target Start/End: Original strand, 56554607 - 56554825
Alignment:
| Q |
36 |
taccgttgtccgtgttgagagggatggtttgggtttgggcgagagagacgcagacaaggtggaggagaaggcattgaaattagggtttggcttgtcctta |
135 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56554607 |
taccgttgtccgtgttgagagggattgtttgggtttgggcgagagagacgcagacaaagtggaggagaaggcattgaaattagggtttggcttgtccttg |
56554706 |
T |
 |
| Q |
136 |
ttgaaagaagaataataatgtggatgtggatagaatagatatgaagatgaagcgatgatggtattggtggtgtagtaacccccaaacaagtttggagtta |
235 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56554707 |
ttgaaagaagaataaaaatgtggatgtggatagaatagatatgaagatgaagcgatgatggtattggtggtgtagtaacccccaaacaagtttggagtta |
56554806 |
T |
 |
| Q |
236 |
gagtagcagtggcactcat |
254 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
56554807 |
gagtagcagtggcactcat |
56554825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University