View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_85 (Length: 268)
Name: NF13777_low_85
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_85 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 70 - 228
Target Start/End: Complemental strand, 18891866 - 18891708
Alignment:
| Q |
70 |
tgctactagttaccattcaaatgaatttcaactataaacaaatgaaaagtcaaagatgaaaataactccatcggctgtgttatgttgggcttctgaattt |
169 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18891866 |
tgctagtagctaccattcaaatgaatttcaactataaacaaatgaaaagtcaaagatgaaaataactccatcggctgtgttatgttgggcttctgaattt |
18891767 |
T |
|
| Q |
170 |
cttttcacactctatctttacttaaatacaccacatatcttttgtatgatatttcctct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
18891766 |
cttttcacactctatctttacttaaatacaccgcatatcttttgtatgataattcctct |
18891708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 50
Target Start/End: Complemental strand, 18891898 - 18891867
Alignment:
| Q |
19 |
acttcatccattgttgttttcataaaataatt |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18891898 |
acttcatccattgttgttttcataaaataatt |
18891867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University