View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_96 (Length: 242)
Name: NF13777_low_96
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 11300702 - 11300489
Alignment:
| Q |
18 |
cttcttctatggatttcaactccacagaacaacacattcaccacgacgacaacaacaacaacattggtatgaagaaacctgaagtattccaagacgttga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
11300702 |
cttcttctatggatttcaactccacagaacaacacattcac------gacaacgacaacaacattggtatggagaaaccggaagtattccaagacgttga |
11300609 |
T |
 |
| Q |
118 |
t-------gatgatg-ttgtacttgacgttgtggctaaagagaaacaaggtacgtacatgacatatcgttttcgttcagaacaacatgcatgcattgact |
209 |
Q |
| |
|
| || | || |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11300608 |
ttgtacttgacgttgattgtacttgacgttgtgggtaaagagaaacatggtacgtacatgacatatcgttttcgttcacaacaacatgcatgcattgact |
11300509 |
T |
 |
| Q |
210 |
tagatatgagaaatgttatt |
229 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11300508 |
tagatatgagaaatgttatt |
11300489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University