View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13777_low_97 (Length: 241)
Name: NF13777_low_97
Description: NF13777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13777_low_97 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 40142739 - 40142520
Alignment:
| Q |
7 |
aaaataaggcttaaacatgttttgaggtcatcaagcaagataaatatcgttcttgtgcatgtttgaaatcaaaggtggatttgacaaaatcatggtgact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40142739 |
aaaataaggcttaaacatgttttgaggtcatcaagcaagataaatatcgttcttctgcatgtttgaaatcac-ggtggatttgacaaaatcatggtgact |
40142641 |
T |
 |
| Q |
107 |
tggttgatgtttcaaagtgtcgtttttgcaaaatcatggtatgccaaacacaccatcaattcaaacatgcactttgtatctcaaaaaagttttgttgctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40142640 |
tggttgatgtttcaaagtgtcgtttttgcaaaatcatggtttgccaaacactccatcaattcaaacatgcactttgtatctcgaaaaagttttgttgctt |
40142541 |
T |
 |
| Q |
207 |
ttttcaaaatgatcataattg |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40142540 |
ttttcaaaatgatcataattg |
40142520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University