View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13778_high_13 (Length: 206)
Name: NF13778_high_13
Description: NF13778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13778_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 29 - 193
Target Start/End: Complemental strand, 25476387 - 25476212
Alignment:
| Q |
29 |
tcagttttcacatggcattagagctctcgatcactaggggccttgcttccgcataaaccttagccaccttaattgtggcctcttttgttgccttcgttgc |
128 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25476387 |
tcagttttcacatggcatcagagctctcgatcactaggggccttgcttccgcataaaccttagccaccttaattgtggcctcttttgttgccttcgttgc |
25476288 |
T |
 |
| Q |
129 |
agtttc-----------agcctcaaaacatggttcaccaaagcaggtattgttcacaactgtcgatactattcatc |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25476287 |
agtttcagccacaaaacagcctcaaaacatggttcaccaaagcaggtattgttcacaactgtcgatactattcatc |
25476212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University