View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13778_high_7 (Length: 312)
Name: NF13778_high_7
Description: NF13778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13778_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 39725311 - 39725100
Alignment:
| Q |
14 |
ctctcttgatttaattttctgccgttgactgcatcataaaatctttgatttaattgtttaagaacgactgtactataaaaccgcattagaaaatctaatg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39725311 |
ctctcttgatttaattttctgccgttgattgcatcataaaagctttgatttaattgtttaagaacgactgtactataaaaccgcattagaaaatctagtg |
39725212 |
T |
 |
| Q |
114 |
attggattagaactttatagaaagatctaactcacacaaagtcaaaacatggacgatcaaatacattgcgtgactaggtgcaatttatgttgcatgcttg |
213 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39725211 |
gttggattagaactttgtagaaagatctaactcacacaaagtcaaaacatggccgatcaaatacattgcgtgactaggtgcaatttatgttgcatgcttg |
39725112 |
T |
 |
| Q |
214 |
tagtttatttaa |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39725111 |
tagtttatttaa |
39725100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University