View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13778_low_12 (Length: 228)
Name: NF13778_low_12
Description: NF13778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13778_low_12 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 39087878 - 39088102
Alignment:
| Q |
7 |
agttgttccatggagttggagagaatctgtatccattgatctactttgctctgttgttgtgagttttgattcattgttgaatgaatcattatttggtgtt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39087878 |
agttgttccatggagttggagagaatctgtatccattgatctactttgctctgttgttgtgagttttgattcattgttgaatgaatcattatttggtgtt |
39087977 |
T |
|
| Q |
107 |
gaatgtttggaatgnnnnnnnggttgccttggtttgtctgatttttcctttgcatgtgactctctaatgtttcc---tgatgaatgtgagtgttgcttag |
203 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39087978 |
gaatgtttcgaatgtttttttggttgccttggtttgtctgatttttcctttgcatgtgactctctaatgtttcctgatgatgaatgtgagtgttgcttag |
39088077 |
T |
|
| Q |
204 |
atgatttaggcaagggcaactcatt |
228 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39088078 |
atgatttaggcaagggcaactcatt |
39088102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University