View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13778_low_16 (Length: 204)
Name: NF13778_low_16
Description: NF13778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13778_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 20185652 - 20185840
Alignment:
| Q |
1 |
tatgtttattgattcttacattaaaatgtttcaaattgtcaaaagataaaactaaatctaaactcaaagaagcaattaggtaggaataggatttggataa |
100 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20185652 |
tatgtctattgattcttacgttaaaatgtttcaaattgtcaaaagataaaactaaatctaaattcaaagaagcaattaggtaggaataggatttcgataa |
20185751 |
T |
 |
| Q |
101 |
tgaagagatggattaacatcatttagctttgatccaattcggaattcttagactagtcctcccctaaaattgaaatgaatggccttcct |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20185752 |
cgaagagatggattaacatcatttagctttgatccgattcagaattcttagactagtcctcccctaaaattgaaatgaatggccgtcct |
20185840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 14515966 - 14516029
Alignment:
| Q |
5 |
tttattgattcttacattaaaatgtttcaaattgtcaaaagataaaactaaatctaaactcaaag |
69 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||||||||||||||||||| |||| |||||| |
|
|
| T |
14515966 |
tttattgattcttatgttaaaatgtttcaacta-tcaaaagataaaactaaatataaattcaaag |
14516029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University