View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13778_low_3 (Length: 432)
Name: NF13778_low_3
Description: NF13778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13778_low_3 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 2e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 275 - 432
Target Start/End: Original strand, 33116619 - 33116776
Alignment:
| Q |
275 |
agctaatcaatagtattatatatgcagctgttaccaggtgcatgcttgatctcaaatgacatgacaaagaaccaatgtcaaaaaggacacagatcatggt |
374 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116619 |
agctaatcaagagtattatatatgcagctgttaccaggtgcatgcttgatctcaaatgacatgacaaagaaccaatgtcaaaaaggacacagatcatggt |
33116718 |
T |
 |
| Q |
375 |
atacacaaggatgtcctagcaaattgggttggcttgcactgattggattggctctcta |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33116719 |
atacacaaggatgtcctagcaaattgggttggcttgcactgattggattggctctcta |
33116776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 37 - 85
Target Start/End: Complemental strand, 11040976 - 11040928
Alignment:
| Q |
37 |
catgataagaatgtatgctataatcgcttaatcaagttgtttaaccaaa |
85 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
11040976 |
catgataagaatttatgctataggcgcttaattaagttgtttatccaaa |
11040928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University