View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377_high_11 (Length: 413)
Name: NF1377_high_11
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 40 - 407
Target Start/End: Original strand, 37169803 - 37170170
Alignment:
| Q |
40 |
cactgatacaagtttcaaagttcaaaccctctgttgtgttgtgtgcaatcgacagtgaaacccatactattccaatctttttcttcttctgttgtaccat |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37169803 |
cactgatacaagtttcaaagttcaaaccctctgttgtgttgtgtgcaatcaacagtgaaacccatactattccaatctttttcttcttctgttgtaccat |
37169902 |
T |
 |
| Q |
140 |
gttagaaactggtgcacgtgattctgagttgagtttagaaactgtgaattcaacacagcgaagctcaatgagcagtgaaagcatttgcagcactagtttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37169903 |
gttagaaactggtgcacgtgattctgagttgagtttagaaactgtgaattcaacacagcgaagctcaatgagcagtgaaagcatttgcagcactagtttc |
37170002 |
T |
 |
| Q |
240 |
agccgtctctcattcgaccttcttcctccttcaccggatagtctcgccctcaaacctcaccgctcctccgacttcgcttactccgccatccgtcgcaagc |
339 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170003 |
agccgtctttcattcgaccttcttcctccttcaccggagagtctctccctcaaacctcaccgctcctccgacttcgcttactccgccatccgtcgcaagt |
37170102 |
T |
 |
| Q |
340 |
ccgctctcacatttcgtgacttccacctcctccgccgtatcggcgccggagatatcggtactgtttac |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37170103 |
ccgctctcacatttcgtgacttccacctcctccgccgtatcggcgccggagatatcggtactgtttac |
37170170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 211 - 388
Target Start/End: Complemental strand, 6073798 - 6073621
Alignment:
| Q |
211 |
gcagtgaaagcatttgcagcactagtttcagccgtctctcattcgaccttcttcc-tcct--tcaccggatagtctcgccctcaaacctcaccgctcctc |
307 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| |||||||| ||||| |||| || ||||| |||| || |||||||||| || ||||| |
|
|
| T |
6073798 |
gcagtgaaagcatttgcagcaccagcttcagccgtctctccttcgacctacttccatcctcctcgccggaatctctctccatcaaacctcatcgttcctc |
6073699 |
T |
 |
| Q |
308 |
cgacttcgcttactccgccatccgtcgcaagcccgctctcacatttcgtgacttccacctcctccgccgtatcggcgccgg |
388 |
Q |
| |
|
||||||||| ||| |||||||| ||||| ||| ||||| || ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
6073698 |
cgacttcgcctacaccgccatc---cgcaaatccggcctcaccttccgtgacttccatctcctccgccgtataggcgccgg |
6073621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University