View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377_high_27 (Length: 264)
Name: NF1377_high_27
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377_high_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 221
Target Start/End: Original strand, 43428918 - 43429124
Alignment:
| Q |
9 |
tgctaaattttgtagataatccattaaaacatcctgtcctttatgaaatctctgtggtgttgtacttgtatgtcaatcttgtttacatctattgttttcg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43428918 |
tgctaaattttgtagataatccattaaaacatcctgtcctttatgaaatctctgtggtgttgt------atgtcaatcttgtttacatctattgttttcg |
43429011 |
T |
|
| Q |
109 |
tacaagaataaaatatgctaaaaccaccaaaggtttcgaatgaagggagtatttgttttagcatttttaagatataatttgaatgaccagtttttgacta |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43429012 |
tacaagaataaaatatgctaaaaccaccaaaggtttcgaatgaagggagtatttgttttagcatttttaagatctaatttgaatgaccagtttttgacta |
43429111 |
T |
|
| Q |
209 |
tagtaggagtatg |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43429112 |
tagtaggagtatg |
43429124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University