View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377_low_18 (Length: 342)
Name: NF1377_low_18
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 84 - 248
Target Start/End: Complemental strand, 12281598 - 12281434
Alignment:
| Q |
84 |
aatatggacccgtaatgtacctaaaaatgggatcacacaacatggttgtagcctcaacaccttcttcagccaaagcatttcttaaaacacttgaccaaaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
12281598 |
aatatggacccgtaatgtacctaaaaatgggatcacacaacatggttgtagcctcaacgccttcttcagccaaagcatttcttaaaacacttgacctaaa |
12281499 |
T |
|
| Q |
184 |
tttttcaaataggccgccgaacgctggcgcaacacacctagcttatgattcacaagacatggttt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12281498 |
tttttcaaataggccgccgaacgctggcgcaacacacctagcttatgattcacaagacatggttt |
12281434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University