View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377_low_27 (Length: 292)
Name: NF1377_low_27
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 32 - 283
Target Start/End: Original strand, 10268912 - 10269165
Alignment:
| Q |
32 |
taatagttttgtattgaaaataataaatgtttaactcttataagtagaaaatgccactttaaaca--atataaaggctaaatagtttaattgatttgagt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
10268912 |
taatagttttgtattgaaaataataaatgtttaactcttataagtagaaaatgccactttaaacacaatataaaggctaaataatttaattgatttgagt |
10269011 |
T |
 |
| Q |
130 |
taagagatgatagtttgatgttttgagtttaaatctaaacgaagaagtaaatattgctctaatcttaagttttcaaaagagttttgccatttnnnnnnnn |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10269012 |
taagagatgatagtttgatgttttgagtttaaatctaaacgcagaagtaaatattactctaatcttaagttctcaaaagagttttgccatttaaaaaaaa |
10269111 |
T |
 |
| Q |
230 |
gctttgcaacatgatatttttatattcgtttgttcatttaaccaatgcctatga |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10269112 |
gctttgcaacatgatatttttatattcgtttgttcatttaaccaatgcctatga |
10269165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University