View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1377_low_27 (Length: 292)

Name: NF1377_low_27
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1377_low_27
NF1377_low_27
[»] chr5 (1 HSPs)
chr5 (32-283)||(10268912-10269165)


Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 32 - 283
Target Start/End: Original strand, 10268912 - 10269165
Alignment:
32 taatagttttgtattgaaaataataaatgtttaactcttataagtagaaaatgccactttaaaca--atataaaggctaaatagtttaattgatttgagt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||| ||||||||||||||||    
10268912 taatagttttgtattgaaaataataaatgtttaactcttataagtagaaaatgccactttaaacacaatataaaggctaaataatttaattgatttgagt 10269011  T
130 taagagatgatagtttgatgttttgagtttaaatctaaacgaagaagtaaatattgctctaatcttaagttttcaaaagagttttgccatttnnnnnnnn 229  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||            
10269012 taagagatgatagtttgatgttttgagtttaaatctaaacgcagaagtaaatattactctaatcttaagttctcaaaagagttttgccatttaaaaaaaa 10269111  T
230 gctttgcaacatgatatttttatattcgtttgttcatttaaccaatgcctatga 283  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10269112 gctttgcaacatgatatttttatattcgtttgttcatttaaccaatgcctatga 10269165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University