View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377_low_32 (Length: 268)
Name: NF1377_low_32
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 47 - 241
Target Start/End: Original strand, 49662417 - 49662611
Alignment:
| Q |
47 |
caccagtaattcaaccttctttattagacaaaagggggtgacaaagatccaactcttgaacacttagttatagaaaccggcaccgctttatgaaaagatt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
49662417 |
caccagtaattcaaccttctttattagacaaaagggggtgacaaagatccaactcttgaacacttggttatagaaaccggcactgctttatgaaaagatt |
49662516 |
T |
|
| Q |
147 |
gtccgaaaagcttaaggtgttaggtgaagaaacatttttagtttgtatatgtaacttctgatatatgtgtgtgaatgtagtgtacataagtataa |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49662517 |
gtccgaaaagcttaaggtgttaggtgaagaaacatttttagtttgtatatgtaacttctgatatatgtgtgtgaatgtagtgtacataagtataa |
49662611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 25933 times since January 2019
Visitors: 1215