View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1377_low_33 (Length: 264)
Name: NF1377_low_33
Description: NF1377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1377_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 32 - 150
Target Start/End: Complemental strand, 39103717 - 39103604
Alignment:
| Q |
32 |
aatgtagtaaagtatgaatatagatcaatcatcaccaaatagtgctaatactacaatattaagcttttcgtcttcatatgcatggcatgaaaataaggtt |
131 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| ||||||||| | |||||||||||||| | |||||||||||| ||||||||||||||| |
|
|
| T |
39103717 |
aatgtagtaaagtttgaatctagatcaatcatcaccaaacagtgctaatcc---aatattaagctttt--ttttcatatgcatgtcatgaaaataaggtt |
39103623 |
T |
 |
| Q |
132 |
ggaaatatgaatgataaaa |
150 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39103622 |
ggaaatatgaatgataaaa |
39103604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 107 - 158
Target Start/End: Complemental strand, 39112633 - 39112581
Alignment:
| Q |
107 |
atatgcatggcatgaaaataaggttgg-aaatatgaatgataaaataaaaata |
158 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39112633 |
atatgcatggcatgaaaataaggttggaaaatatgaatgataaaataaaaata |
39112581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 180 - 214
Target Start/End: Complemental strand, 39103517 - 39103483
Alignment:
| Q |
180 |
acacaagaaagaggaagagggggaaataacgttgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39103517 |
acacaagaaagaggaagagggggaaataacgttgt |
39103483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 156 - 185
Target Start/End: Complemental strand, 39103554 - 39103525
Alignment:
| Q |
156 |
atagttaccagcgattgaattgaaacacaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39103554 |
atagttaccagcgattgaattgaaacacaa |
39103525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 76
Target Start/End: Complemental strand, 39112694 - 39112646
Alignment:
| Q |
29 |
agcaatgtagtaaagtatgaata-tagatcaatcatcaccaaatagtgc |
76 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
39112694 |
agcaatgtagtaaagtttgaattctagatcaatcatcatcaaatagtgc |
39112646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University