View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13780_high_10 (Length: 248)

Name: NF13780_high_10
Description: NF13780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13780_high_10
NF13780_high_10
[»] chr6 (1 HSPs)
chr6 (172-231)||(1828497-1828556)


Alignment Details
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 172 - 231
Target Start/End: Original strand, 1828497 - 1828556
Alignment:
172 aaatcaagaagtacatggataatatgttttaaactgaacgttgagtagggagacattatt 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1828497 aaatcaagaagtacatggataatatgttttaaactgaacgttgagtagggagacattatt 1828556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University