View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13780_high_19 (Length: 202)
Name: NF13780_high_19
Description: NF13780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13780_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 13 - 186
Target Start/End: Original strand, 33127740 - 33127913
Alignment:
| Q |
13 |
ctgagaagaaaacaaaaggagatcacaaatctgtagtgttgtctattaatgttccaaacaaaaaagtgttcttgaattannnnnnnnnnnnnnnnatcat |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33127740 |
ctgaaaagaaaacaaaaggagatcacaaacctgcagtgttgtctattaatgttccaaacaaaaaagtgttcttgaattattttttgagtttttttatcat |
33127839 |
T |
 |
| Q |
113 |
ggtaaatttgcatttaattttgaacaattacacattcgatcaatgacattttagtcattagtgttgcatctgaa |
186 |
Q |
| |
|
|||||||||||| |||||||||||||| || | ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33127840 |
ggtaaatttgcaattaattttgaacaagtagagattcgatcaatgacattttagtcgttagtgttgcatctgaa |
33127913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University