View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13780_low_12 (Length: 236)
Name: NF13780_low_12
Description: NF13780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13780_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 197
Target Start/End: Complemental strand, 43380954 - 43380764
Alignment:
| Q |
7 |
cttatgtttcttagctgcatgcagaattgtttgcaagatctgcaggggatccccatggctgacaaccaaaatcgcacatctgcatgatgtggaatggaat |
106 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43380954 |
cttatgtttcttagctgcatgaagaattgtttgcaagatctgcaggggatccccatggctgacaaccaaaatcgcacatctgaatgatgtggaatggaat |
43380855 |
T |
|
| Q |
107 |
gagattgattgatactagatcacaagccaaaataaaatattcaccaactgaaattttgaaaagtatttgcatgttacggtgaatcttttgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43380854 |
gagattgattgatactagatcacaagacaaaataaaatattgactaactgaaattttgaaaagtatttgcatgttacagtgaatcttttgt |
43380764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 194 - 236
Target Start/End: Complemental strand, 43380718 - 43380676
Alignment:
| Q |
194 |
ttgtgataaaaaagacacatactagaagaatttcaaatgatat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43380718 |
ttgtgataaaaaagacacatactagaagaatttcaaatgatat |
43380676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University