View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13780_low_13 (Length: 236)
Name: NF13780_low_13
Description: NF13780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13780_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 34106112 - 34105903
Alignment:
| Q |
13 |
atgaattcggaataatcttctctaaatttgaactaccactttccaatattttaccaacattttgataaaggttaaatatggtaggattacagaataccga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34106112 |
atgaattcggaataatcttctctaaatttgaactaccactttccaatcttttaccaacattttgataaaggttaaatatggtaggattacagaataccga |
34106013 |
T |
 |
| Q |
113 |
cgagtatgcaatttttctagcattattcacccccacaaccgacatacatatcaggccacaagccaagcttcctcc-nnnnnnnncttctaatattggcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34106012 |
cgagtatgcaatttttctagcattattcacccccacgaccgacatacatatcaggccacaagccaagcttcctccaaaaaaaaacttctaatattggcta |
34105913 |
T |
 |
| Q |
212 |
gcaagtatag |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
34105912 |
gcaagtatag |
34105903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University