View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13780_low_17 (Length: 221)
Name: NF13780_low_17
Description: NF13780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13780_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 54422096 - 54422284
Alignment:
| Q |
15 |
ataggtggtttagaggtgaatagtattttcactacggggaagagaatggtgagcggtgggagagggtgttggcataacaccatcctctatactatttttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54422096 |
ataggtggtttagaggtgaatagtattttcactacggggaagagaatggtgagcggtgggagagggtgttggcataacaccatcctctatactatttttt |
54422195 |
T |
 |
| Q |
115 |
atatgcaagttgaatttccacaccctttccaaataaaaactgagaattccatgctgtgaattttgattatatgatgtcacaagtttcac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54422196 |
atatgcaagttgaatttccacaccctttccaaataaaaactgagaattccatgctgtgaattttgattatatgatgttacaagtttcac |
54422284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 168 - 203
Target Start/End: Original strand, 16647470 - 16647505
Alignment:
| Q |
168 |
ctgtgaattttgattatatgatgtcacaagtttcac |
203 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
16647470 |
ctgtgaattttgattatatgatgtcacgagtttcac |
16647505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University