View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13781_high_10 (Length: 255)
Name: NF13781_high_10
Description: NF13781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13781_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 237
Target Start/End: Complemental strand, 47624879 - 47624651
Alignment:
| Q |
9 |
atgaagataaaattactcaatgggatgaaggatttgctagatagtggtacgaagattcaggctgttcaagcatggggatggtttattcgaatgctcgggt |
108 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624879 |
atgaagataaaattgctcaatgggatgaaggatttgctagatagtggtacgaagattcaggctgttcaagcatggggatggtttattcgaatgctcgggt |
47624780 |
T |
|
| Q |
109 |
cccatgctttgaaaaacaagcatttagttaatgatatgttgaaaatacctgagcgtacatttacagatcctgaccctcaagttcagattgccacacaggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624779 |
cccatgctttgaaaaacaagcatttagttaatgatatgttgaaaatacctgagcgtacatttacagatcctgaccctcaagttcagattgccacacaggt |
47624680 |
T |
|
| Q |
209 |
accatatatcagttactgcattatcccat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47624679 |
accatatatcagttactgcattatcccat |
47624651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University