View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13782_high_29 (Length: 252)
Name: NF13782_high_29
Description: NF13782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13782_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 3 - 158
Target Start/End: Complemental strand, 45387102 - 45386947
Alignment:
| Q |
3 |
atcatagagtagtactatagaggtgtactttagcagtagtatacaaaagcgagagagaaggcaaagacggcataagtgatagttgcacgaagcttatctt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45387102 |
atcatagagtagtactatagaggtgtactttagcagtagtatacaaaagcgagagagaaggcaaagacggcataagtgatagttgcacgaagcttatctt |
45387003 |
T |
|
| Q |
103 |
agaggcagattccttttgtgaaacttgaagccatgggagaggtttttaatgataac |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45387002 |
agaggcagattccttttgtgaaacttgaagccatgggagaggtttctaatgataac |
45386947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University