View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13782_low_26 (Length: 274)
Name: NF13782_low_26
Description: NF13782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13782_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 4 - 191
Target Start/End: Complemental strand, 39228240 - 39228053
Alignment:
| Q |
4 |
gggtagattattctcttcaaacattaatttgctaatactatcagtaaaacttaactaggatagcaaatattgatttacttttgggcgattctattaaaaa |
103 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39228240 |
gggtaaatttttctcttcaaacattaatttgctaatactagcagtaaaacttaactaggatagcaaatattgatttacttttgggcgactctattaaaaa |
39228141 |
T |
 |
| Q |
104 |
cgggtgtttggaagagagcttgttcgagctgatcttatgacccaaacacttgtgtgagtgtttggaagaacttcaaaaaacagcttat |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39228140 |
cgggtgtttggaagagagcttgttcgagctgatcttatgacccaaacacttgtgtgagtgtttggaagaacttcaaaaaacagcttat |
39228053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 190 - 255
Target Start/End: Complemental strand, 39227842 - 39227777
Alignment:
| Q |
190 |
ataatgaaagacatgaacaagagcaatccaataatccattaccgaattgaagataaacaagcaaga |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39227842 |
ataatgaaagacatgaacaagagcaatccaataatccattaccgaattgaagataaacaagcaaga |
39227777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University