View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13782_low_28 (Length: 268)
Name: NF13782_low_28
Description: NF13782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13782_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 101 - 252
Target Start/End: Original strand, 49992079 - 49992230
Alignment:
| Q |
101 |
gacaagaattttcttcaaaacagacatatacttaaagatgaaggtagtataagattcaaagttcactgtatataaatatatattgtggctatgactaaac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49992079 |
gacaagaattttcttcaaaacagacatatacttaaagatgaaggtagtataagattcaaagttcactttatataaatatatattgtggctatgactaaac |
49992178 |
T |
 |
| Q |
201 |
gaatgctcaatcacaaatgttgagatcatataatctattatcaggttaactt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
49992179 |
gaatgctcaatcacaaatgttgagatcatataatccattatcaggttgactt |
49992230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University