View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13782_low_34 (Length: 238)
Name: NF13782_low_34
Description: NF13782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13782_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 1615584 - 1615352
Alignment:
| Q |
1 |
aatcaagtactgtttgatgggaaaaaatcttacttgatgtcacagtcactgtagttgcaggttgcaatcttatgttattttttcccccttattgtatgga |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1615584 |
aatcaagtattgtttgatgggaaaaaatcttac--gatgtcacagtcactgtggttgcaggttgcaatcttatgttattttttcccccttattttatgga |
1615487 |
T |
|
| Q |
101 |
tggtggtgtggctaggtttgaattcatacgctgaagatgatgaagagtgatgctttgacgagaagatgaaaattggacaggtttcttttccctccacgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1615486 |
tggtggtgtggctaggtttgaattcatacgctgaagatgatgaagagtgatgctttgatgagaagatgaaaattggacaggtttcttttccctccacgta |
1615387 |
T |
|
| Q |
201 |
tttatttttgttgttatgatttcatttttgatcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1615386 |
tttatttttgttgttatgatttcatttttgatcat |
1615352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 48 - 229
Target Start/End: Original strand, 24455147 - 24455331
Alignment:
| Q |
48 |
actgtagttgcaggttgcaatcttatgttattttttccc--ccttattgtatggatggtggtgtggctaggtttgaa-ttcatacgctgaagatgatgaa |
144 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||| | || |||| ||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
24455147 |
actgtggttgcaggttgcaatcttatgtttttttttttcttccgtattttatggatggtggtgtggctagatttgaaattcatacgctgaagatgatgaa |
24455246 |
T |
|
| Q |
145 |
gagtgatgctttgacgagaagatgaaaattggacaggtttcttttccctccacgtatttatttttgttgttatgatttcattttt |
229 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||| |
|
|
| T |
24455247 |
gagtgatgcttttatgagaagatgaaatttggacaggtttcttttccctccacatatttctttttgttgttatgatttcgttttt |
24455331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 70 - 158
Target Start/End: Original strand, 43227403 - 43227489
Alignment:
| Q |
70 |
ttatgttattttttcccccttattgtatggatggtggtgtggctaggtttgaattcatacgctgaagatgatgaagagtgatgctttga |
158 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
43227403 |
ttatgttatttttttcc--ttattttatggatggtggtgtggctaggtttgaattcatacgttgaagatgacaaagagtgatgctttga |
43227489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 169
Target Start/End: Complemental strand, 48909326 - 48909245
Alignment:
| Q |
88 |
cttattgtatggatggtggtgtggctaggtttgaattcatacgctgaagatgatgaagagtgatgctttgacgagaagatga |
169 |
Q |
| |
|
|||||| ||||||||||||| | |||||| |||| |||| | | ||||||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
48909326 |
cttattttatggatggtggtcttgctaggcttgagttcaaatgttgaagatgatggagagtgaggctttgatgagaagatga |
48909245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 98 - 165
Target Start/End: Complemental strand, 35361119 - 35361052
Alignment:
| Q |
98 |
ggatggtggtgtggctaggtttgaattcatacgctgaagatgatgaagagtgatgctttgacgagaag |
165 |
Q |
| |
|
|||||||||||||||| ||||| |||||| | ||||||||||||||||||| |||||| |||||| |
|
|
| T |
35361119 |
ggatggtggtgtggctctatttgagttcataggttgaagatgatgaagagtgagactttgatgagaag |
35361052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University