View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13783_high_24 (Length: 306)
Name: NF13783_high_24
Description: NF13783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13783_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 11 - 199
Target Start/End: Original strand, 51189212 - 51189402
Alignment:
| Q |
11 |
cacagacagggaattttgataagataccggtattagtaggacaaataaat--tcttataaattttgaatttaatacatattatttaggtaggttttcttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189212 |
cacagacagggaattttgataagataccggtattagtaggacaaataaatattcttataaattttgaatttaatacatattatttaggtaggttttcttt |
51189311 |
T |
 |
| Q |
109 |
ggttggagactttgtttgatttaannnnnnnnagaggaaaagaaaatggcgcaaaattattccaaagtcaattttagctctcctttaattt |
199 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51189312 |
ggttggagactttatttgatttaattttttttagaggaaaagaaaagggcgcaaaattattccaaagtcaattttaggtctcctttaattt |
51189402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 203 - 281
Target Start/End: Original strand, 51189432 - 51189499
Alignment:
| Q |
203 |
tagagggatgtacaaaattcatcctttccgtgaatatgtcccgagtatgaccctaaaccaaaaaaggttgacaaatggg |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51189432 |
tagagggatgtacaaaattcatcctttccgtgaa-----------tatgaccctaaaccaaaaaaggttgacaaatggg |
51189499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University