View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13783_high_32 (Length: 248)
Name: NF13783_high_32
Description: NF13783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13783_high_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 12 - 230
Target Start/End: Original strand, 31633815 - 31634033
Alignment:
| Q |
12 |
atcaacaatgctctccaacataaaatagttaaccatttgagctccattcacactacaattaaactgaggtgaaaaactatctggtataggaaatggagtg |
111 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||||||||||| |||||| | |||||| |||||||| || ||||| |||||||| ||| ||||||| ||| |
|
|
| T |
31633815 |
atcagcaacgctctccaacataaaataattaaccatttgagttccatttatactacagttaaactgcggggaaaagctatctggcataagaaatggggtg |
31633914 |
T |
|
| Q |
112 |
taaggacaatcatagtagagtgtcaagttatgagaatccgaaccataatcgaagaaagtgcaatctaaagttgtgttcttaaggttggtgggacaaacat |
211 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||| |
|
|
| T |
31633915 |
tgaggacaatcatagtagagtgtcaaattatgagaatccgaaccataatcgaagaaagtgcaatctaatgttgtgtttttaaggctggtgggacaaacat |
31634014 |
T |
|
| Q |
212 |
tgttccaataatcagttct |
230 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31634015 |
tgttccaataatcagttct |
31634033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 19991458 - 19991507
Alignment:
| Q |
184 |
gtgttcttaaggttggtgggacaaacattgttccaataatcagttcttac |
233 |
Q |
| |
|
|||||||||| |||||||||||||| ||| ||||| ||||| |||||||| |
|
|
| T |
19991458 |
gtgttcttaaagttggtgggacaaatattattccattaatcggttcttac |
19991507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University