View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13783_high_34 (Length: 234)
Name: NF13783_high_34
Description: NF13783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13783_high_34 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 35824 - 36057
Alignment:
| Q |
1 |
ttcaaactcgtatgttcatctctatcactcacttttaatgtgtctcctaatatatagatgatattcatatatttatgtcttaactccgcttctacttttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35824 |
ttcaaactcgtatgttcatctctatcactcacttttaatgtgtctcctaatatatagatgatattcatatatttatgtcttcactccgcttctacttttt |
35923 |
T |
 |
| Q |
101 |
agttgttcaatctcacattatgcatgttcacagatatcaaaattgagtatgattcccgtggtttgtgttatggaaaggattcttcacaacaagcactttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35924 |
agttgttcaatctcacattatgcatgttcacagatatcaaaattgagtatgattcccgtggtttgtgttatggaaaggattcttcacaacaagcactttt |
36023 |
T |
 |
| Q |
201 |
caaggaaagtgaaaatttcagtggtggttgtggt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36024 |
caaggaaagtgaaaatttcagtggtggttgtggt |
36057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 130 - 214
Target Start/End: Complemental strand, 8676696 - 8676612
Alignment:
| Q |
130 |
acagatatcaaaattgagtatgattcccgtggtttgtgttatggaaaggattcttcacaacaagcacttttcaaggaaagtgaaa |
214 |
Q |
| |
|
||||||||||||| | || |||||||| ||||||||||| |||||| |||| ||||||| ||| |||| |||||| |||||||| |
|
|
| T |
8676696 |
acagatatcaaaactaagcatgattccggtggtttgtgtgatggaatggatccttcacagcaaacactactcaagggaagtgaaa |
8676612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University