View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13783_high_40 (Length: 206)
Name: NF13783_high_40
Description: NF13783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13783_high_40 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 114 - 190
Target Start/End: Original strand, 7404756 - 7404832
Alignment:
| Q |
114 |
tatgcctagtattggactggtgttttatgttgtaaggtcatgatcatgatggacttcaaggcagtggctcttttcca |
190 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
7404756 |
tatgcctagtactggactggtgttttatgttgtaaggtcatgagcatgatggacttctaggtagtggatcttttcca |
7404832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University