View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13783_low_21 (Length: 325)
Name: NF13783_low_21
Description: NF13783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13783_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 20 - 315
Target Start/End: Complemental strand, 26037851 - 26037556
Alignment:
| Q |
20 |
attgtgcttagatacaccttcttcagcgatggaaattgcactaaagaatgtttaaacttcatattgtattcaccacatagactgcaaagtttccaaaaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26037851 |
attgtgcttagatacaccttcttcagcgatggaaattgcactaaagaatgtttaaacttcatattgtattcaccacctagactgcaaagtttccaaaaga |
26037752 |
T |
 |
| Q |
120 |
caggttatagagcattctagttttgtttccaccatgagtttaccaatttcgtaggattaaaaattagtttaaagataaatagtaaatagtttgtattgat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
26037751 |
caggttatagagcattctagttttgtttccaccatgagtttaccaatttcgtaggattaaaaattagtttaaagataaatagtaattagtttgtattgat |
26037652 |
T |
 |
| Q |
220 |
attgtgatattaactggtttaaattacattaccggagggaaacgaggttgttgcagctcgtgaagaaggaaagagggaggtttatgtcagcttcat |
315 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26037651 |
attgcgatagtaactggtttaaattacattaccggagggaaacgaggttgttgcagctcgtgaagaaggaaagagggaggtttatgtcagcttcat |
26037556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 298
Target Start/End: Complemental strand, 30077178 - 30077129
Alignment:
| Q |
249 |
taccggagggaaacgaggttgttgcagctcgtgaagaaggaaagagggag |
298 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||| |||| ||||||| |
|
|
| T |
30077178 |
taccggagggaaacgaggttgttgcagttgatgaagagggaaggagggag |
30077129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University