View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13783_low_34 (Length: 268)
Name: NF13783_low_34
Description: NF13783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13783_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 4 - 257
Target Start/End: Complemental strand, 7871682 - 7871429
Alignment:
| Q |
4 |
tcaatgatagggtgtaaaggacagcatnnnnnnntgatacataaaagagaggtaggcatgatacagtgaatctatgtgaaagatatataatatggggtaa |
103 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7871682 |
tcaatgatagggtgtaaaggacagcataaaaaaatgatacataaaagagaggtaggcatgatacagtgaatctatgtgaaagatatataatatggggtaa |
7871583 |
T |
 |
| Q |
104 |
tgtatattttcttggattcatgagttttttccctatgatttagttagtcatggttgtgttgaaatatgctgcatactggtgcagtatcttgtaattttgg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7871582 |
tgtatattttcttggattcatgagttttttccctatgatttagttagtcatggttgtgttgaaatatgctgcatactggtgcagtatcttgtaattttgg |
7871483 |
T |
 |
| Q |
204 |
cagtagtggcattctttttacgcgtttttactttggtttacttgtgtgatgatg |
257 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7871482 |
cagtagtggcattctttttatgcgtttttactttggtttacttgtgtgatgatg |
7871429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University