View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13785_high_5 (Length: 268)
Name: NF13785_high_5
Description: NF13785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13785_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 15145338 - 15145564
Alignment:
| Q |
11 |
atgaatgatcgtgaaacaaaaccattttttcctggtcgtgatccagctatgataggaagtgcaaatgggcccttgccctttcagccacgagactgtgctg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15145338 |
atgaatgatcgtgaaacaaaaccattttttcctggtcgtgatccagctatgataggaagtgcaaatgggcccttgccctttcagccacgag--------- |
15145428 |
T |
 |
| Q |
111 |
tttcggagtctgctactccgtttaactatgtgagggataactggat----gaccccgagacataggtttatcaatatgcagctgacaaatccaaattatg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15145429 |
--------tctgctactccgtttaactatgtgagggataactggatcgatgaccccgagacataggtttatcaatatgcagctgacaaatccaaattatg |
15145520 |
T |
 |
| Q |
207 |
ctgttattccagaagcatcacaagcactctccttgccggttata |
250 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15145521 |
ctgttcttccagaagcatcacaagcactctccttgccggttata |
15145564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University