View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13785_high_7 (Length: 223)
Name: NF13785_high_7
Description: NF13785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13785_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35085379 - 35085170
Alignment:
| Q |
1 |
aaaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggtttggannnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35085379 |
aaaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggtttggatttttt |
35085280 |
T |
 |
| Q |
101 |
ngagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatgtcgtccctctctttggtctcttgctggggag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35085279 |
tgagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatgtcgtccctctctttggtctcttgctggggag |
35085180 |
T |
 |
| Q |
201 |
ttggttttga |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35085179 |
ttggttttga |
35085170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35100686 - 35100477
Alignment:
| Q |
1 |
aaaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggtttggannnnnn |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35100686 |
aaaatttagggttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcaatgcgggtttataagtgtcgtctggtttggatttttt |
35100587 |
T |
 |
| Q |
101 |
ngagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatgtcgtccctctctttggtctcttgctggggag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35100586 |
tgagtttgaatcggaagtggttctgggtataaactctggtaccagtagccctcggccgcccatatgatggtgtccctctctttggtctcttgctggggag |
35100487 |
T |
 |
| Q |
201 |
ttggttttga |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35100486 |
ttggttttga |
35100477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 2 - 89
Target Start/End: Original strand, 43026898 - 43026983
Alignment:
| Q |
2 |
aaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgtcgtctggt |
89 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| |||||||| |||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43026898 |
aaatctagggttttggtttcgatttgtaattggggatttacaatgtgga--ggggtaattcagtgcgggtttataagtgtcgtctggt |
43026983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 42795462 - 42795539
Alignment:
| Q |
2 |
aaatttagtgttttggtttcgatttgtaattagggatttatgatgtagatgggggtaattcagtgcgggtttataagtgt |
81 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||| ||||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
42795462 |
aaatttagggttttggtttcgatttgtaattaggaatttacgatgtgga--ggggtaactcagtgcgggtttataagtgt |
42795539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University