View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13785_low_1 (Length: 496)
Name: NF13785_low_1
Description: NF13785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13785_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 209
Target Start/End: Complemental strand, 22121318 - 22121118
Alignment:
| Q |
9 |
acatcatcagcattaagtgctgcagacatgccatcatagaaatctggacgagaaaaaatggcctgattcactgcaacatagcaaaaaaccagaactttaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22121318 |
acatcatcagcattaagtgctgcagacatgccatcatagaaatctggacgagaaaaaatggcctgattcactgcaacatagcaaaaaaccagaactttaa |
22121219 |
T |
 |
| Q |
109 |
aatctacaaaatgttaatgtttatgaccaaatcactgttaattttatcatcacagcttcataaaacctctattggttctgaatttcatagttcatgttgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22121218 |
aatctacaaaatgttaatgtttatgatcaaatcactgttaattttatcatcacagcttcataaaacctctattggttctgaatttcatagttcatgttgc |
22121119 |
T |
 |
| Q |
209 |
t |
209 |
Q |
| |
|
| |
|
|
| T |
22121118 |
t |
22121118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University