View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13785_low_6 (Length: 235)
Name: NF13785_low_6
Description: NF13785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13785_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 42732971 - 42733191
Alignment:
| Q |
1 |
attcaaattcaatttacagcactaacagtcaaacacacaaatgggtgtgtttcatccgcaacacagtaagtatcaggacataaattgtcaaacacacatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
42732971 |
attcaaattcaatttacagcactaacagtcaaacacacaaatgggtgtgtttcatctgcaacacagtaagtatcatgatataaattgtcaaacacacatt |
42733070 |
T |
 |
| Q |
101 |
tgatgaagacaaaatttttaatttttatcatatctattgctttcaagttgtctnnnnnnnntataactttgaagctagaatttgaaatttttgactttta |
200 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| |||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42733071 |
tgatgaagacaaaaattttaatttttgtcatgtctattgccttcaagttgtctaaaaaaaatataactttgaaggtagaatttgaaatttttgactttta |
42733170 |
T |
 |
| Q |
201 |
aacagatttttagtggcaaat |
221 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
42733171 |
aacagatttttagttgcaaat |
42733191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University