View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13785_low_8 (Length: 221)
Name: NF13785_low_8
Description: NF13785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13785_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 204
Target Start/End: Original strand, 33769213 - 33769399
Alignment:
| Q |
18 |
aaacatggatcagtgtttatatcttgaaggtctatgatagggacactgaacttggaagatgcttcactttcatgatcagagttcaagttcaaattgggag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769213 |
aaacatggatcagtgtttatatcttgaaggtctatgatagggacactgaacttggaagatgcttcactttcatgatcagagttcaagttcaaattgggag |
33769312 |
T |
 |
| Q |
118 |
aatgaaacatacgtgggatctttgtcgtacatattccagattctaagaggcctttcacgccggtttttgattcttcaaaggctttca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769313 |
aatgaaacatacgtgggatctttgtcgtccatattccagattctaagaggcctttcacgccggtttttgattcttcaaaggctttca |
33769399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 17 - 209
Target Start/End: Original strand, 33772494 - 33772692
Alignment:
| Q |
17 |
caaacatggatcagtgtttatatcttgaaggtctatgatagggacactgaacttggaagatgcttcactttcatgatcagagttc------aagttcaaa |
110 |
Q |
| |
|
||||||||| | |||| ||||| ||||||||||||||| |||||| ||||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
33772494 |
caaacatgggtttgtgtgtatattttgaaggtctatgatggggacattgaacttggaagatgggtcactttcatgagtggagttcatgttcaagttcaaa |
33772593 |
T |
 |
| Q |
111 |
ttgggagaatgaaacatacgtgggatctttgtcgtacatattccagattctaagaggcctttcacgccggtttttgattcttcaaaggctttcatttca |
209 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| ||||||||||||||| ||||| |||||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
33772594 |
ttgggataatggaacatacgtgggatctttgtcacacatattccagattccaagagacctttcacaccaacttttgattcttcaaaggctttcacttca |
33772692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 118 - 209
Target Start/End: Original strand, 33764468 - 33764559
Alignment:
| Q |
118 |
aatgaaacatacgtgggatctttgtcgtacatattccagattctaagaggcctttcacgccggtttttgattcttcaaaggctttcatttca |
209 |
Q |
| |
|
|||| ||||||||||||||||||||| ||| |||||||||||| ||||||||| || || | ||||||||| ||||| ||||||| |||| |
|
|
| T |
33764468 |
aatggaacatacgtgggatctttgtcacgcatgttccagattctacgaggccttttacaccagcttttgattcgtcaaaagctttcacttca |
33764559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 78
Target Start/End: Original strand, 33764352 - 33764413
Alignment:
| Q |
17 |
caaacatggatcagtgtttatatcttgaaggtctatgatagggacactgaacttggaagatg |
78 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||||| ||||||| ||||| ||||||| |
|
|
| T |
33764352 |
caaacatggattagtgttcatatcttgaaggtcaatgatggggacacacaactttgaagatg |
33764413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University